Warning: require_once(): It is not safe to rely on the system's timezone settings. You are *required* to use the date.timezone setting or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected the timezone 'UTC' for now, but please set date.timezone to select your timezone. in /home/gkatak/public_html/HECOG_CHOLANGIO_MUTATIONS_DATASET/.excel/excel_reader2.php on line 917

Deprecated: Assigning the return value of new by reference is deprecated in /home/gkatak/public_html/HECOG_CHOLANGIO_MUTATIONS_DATASET/.excel/excel_reader2.php on line 917
  A B C D E F G H I J K L
1   Table S1 : Primer sequences and chr coordinates for dd-sequencing of target gene coding regions  
2   Gene Symbol Primer Name Primer info Primer sequence (5'-3') CCDS ID Coding exon Chr band Chr coordinate,
start (GRCh38)
Chr coordinate, stop (GRCh38) Annealing
Temp (C)
 
3   CTNNB1 CTN2Fd Forward outer primer GTCTGCGTTTCACTAACCTG 2694.1 ex1 3p22.1 41223878 41223897 55
4   CTN2Rd Reverse outer primer ATTAGGAGGAGTGAGCAGAA 2694.1     41224208 41224227  
5   CTN2FdM Forward inner primer GTGACATTTAACAGGTATCCCA 2694.1     41223935 41223956 65
6   CTN2RdM Reverse inner primer CAGACTGGCTTAATGGCAAC 2694.1     41224127 41224146  
7   CTN3Fd Forward outer primer TTTCCAATCTACTAATGCT 2694.1 ex2   41224486 41224504 55
8   CTN3Rd Reverse outer primer AAACTATTATACACTAACTTT 2694.1     41224812 41224832  
9   CTN3FdM Forward inner primer CTAATGCTAATACTGTTTC 2694.1     41224497 41224515 62
10   CTN3RdM Reverse inner primer GACTTTCAGTAAGGCAATGA 2694.1     41224770 41224789  
11   CTN4Fd Forward outer primer CTTAGGTAAATGCTGAACTGTG 2694.1 ex3   41224902 41224923 55
12   CTN4Rd Reverse outer primer TTCTGAAACTACTCCCCTT 2694.1     41225257 41225275  
13   CTN4FdM Forward inner primer TGAGTGTTGAATTAACCTT 2694.1     41224929 41224947 60
14   CTN4RdM Reverse inner primer CATTTACTTCAAAGCAGAC 2694.1     41225235 41225253  
15   CTN5Fd Forward outer primer AAGGGGAGTAGTTTCAGAATG 2694.1 ex4   41225257 41225277 55
16   CTN5Rd Reverse outer primer ACTCTTCTACTTTTTAGCTT 2694.1     41225598 41225617  
17   CTN5FdM Forward inner primer CTAACGATGTTTCTGAATTCCT 2694.1     41225303 41225324 60
18   CTN5RdM Reverse inner primer TCTGACATGTTTTCTTACCCA 2694.1     41225570 41225590  
19   CTN6Fd Forward outer primer CACAATATTTCTGATGAGGC 2694.1 ex5   41225623 41225642 55
20   CTN6Rd Reverse outer primer TTAGGAACACTGCATGGAA 2694.1     41225923 41225941  
21   CTN6FdM Forward inner primer ACAATATTTCTGATGAGGCTT 2694.1     41225624 41225644 60
22   CTN6RdM Reverse inner primer AATGCTCCATGAAAACCAC 2694.1     41225882 41225900  
23                    
24 PIK3R1 P3R8Fd Forward outer primer TAAACAAATTATTAGCTCTT 3993.1   5q13.1 68292890 68292909 52
25   P3R8Rd Reverse outer primer TTAACATTTTGGAATAAGGA 3993.1 ex8   68293255 68293274  
26   P3R8FdM Forward inner primer GGAATATGGGCACTCACTGTA 3993.1     68292962 68292982 65
27   P3R8RdM Reverse inner primer TAATATCAGCCCAAAACCCTA 3993.1     68293225 68293245  
28   P3R9Fd Forward outer primer GCTGAAATTAGGGTTTTGG 3993.1 ex9   68293217 68293235 55
29   P3R9Rd Reverse outer primer TTCATCTGCTTCAAATGTT 3993.1     68293548 68293566  
30   P3R9FdM Forward inner primer TTGGGCTGATATTAAAACAT 3993.1     68293232 68293251 60
31   P3R9RdM Reverse inner primer GATCTTGTCTAAACATCGT 3993.1     68293513 68293531  
32   P3R10Fd Forward outer primer ATTGCAATTTTAAAGATGTTTC 3993.1 ex10   68293612 68293633 55
33   P3R10Rd Reverse outer primer ACAAATAAATGCTCTCACC 3993.1     68293940 68293958  
34   P3R10FdM Forward inner primer CCATGTCAGCTATTTTGTTA 3993.1     68293633 68293652 60
35   P3R10RdM Reverse inner primer CATTCGTAAAAACTCAACC 3993.1     68293914 68293932  
36   P3R11Fd Forward outer primer GGATTTTATGAATTTGAGTCCC 3993.1 ex11   68294415 68294436 55
37   P3R11Rd Reverse outer primer ATTCAAAGCACAGAAAGCG 3993.1     68294746 68294764  
38   P3R11FdM Forward inner primer CCCACTCTGCTAATAATACAG 3993.1     68294434 68294454 65
39   P3R11RdM Reverse inner primer ATGGTTTTAGAGGATTTTGGT 3993.1     68294712 68294732  
40   P3R12F Forward outer primer TTTTGCCTGCAGGATTA 3993.1 ex12 & ex13   68295136 68295152 60
41   P3R13R Reverse outer primer AAAATCTTCTGCTATCACCA 3993.1     68295507 68295526  
42   P3R12Fn Forward inner primer TGCCTGCAGGATTATG 3993.1     68295139 68295154 62
43   P3R13Rn Reverse inner primer TTCTGCTATCACCATCTTTAG 3993.1     68295500 68295520  
44                    
45 PIK3CA PI3K20Fd Forward outer primer AGGCTTATCTAGCTATTCGAC 43171.1 ex20 3q26.32 179234114 179234134 55
46   PI3K20Rd Reverse outer primer CAATTCCTATGCAATCGGT 43171.1     179234437 179234455  
47   PI3K20FdM Forward inner primer TTTTCTCAATGATGCTTGGCT 43171.1     179234159 179234179 60
48   PI3K20RdM Reverse inner primer CCTGCTGAGAGTTATTAACAGT 43171.1     179234410 179234431  
49                    
50 PTEN PTEN1Fd Forward outer primer CAGAGCGAGGGGCATCAGCTA 31238.1 ex1 10q23.31 87864348 87864368 58
51   PTEN1Rd Reverse outer primer AGGAAACACAAAATATATGACCT 31238.1     87864671 87864693  
52   PTEN1FdM Forward inner primer TCCAGAGCCATTTCCATCCTG 31238.1     87864377 87864397 62
53   PTEN1RRM Reverse inner primer ATGACCTAGCAACCTGACCA 31238.1     87864658 87864677  
54   PTEN2Fd Forward outer primer ACCACCTTTTATTACTCCA 31238.1 ex2   87893895 87893913 52
55   PTEN2Rd Reverse outer primer ATGATTATAGAGCACTACA 31238.1     87894225 87894243  
56   PTEN2FdM Forward inner primer AGCTATAGTGGGGAAAACTT 31238.1     87893913 87893932 62
57   PTEN2RdM Reverse inner primer AGTATCTTTTTCTGTGGCTT 31238.1     87894186 87894205  
58   PTEN3Fd Forward outer primer AATGGTATTTGAGATTAGGA 31238.1 ex3   87925388 87925407 52
59   PTEN3Rd Reverse outer primer ATCACTACACTTTCTAAATGA 31238.1     87925717 87925737  
60   PTEN3FdM Forward inner primer ATTAGGAAAAAGAAAATCTGT 31238.1     87925401 87925421 62
61   PTEN3RdM Reverse inner primer TTGACTTAATCGGTTTAGGAA 31238.1     87925674 87925694  
62   PTEN4Fd Forward outer primer TCACATTATAAAGATTCAGGC 31238.1 ex4   87930945 87930965 50
63   PTEN4Rd Reverse outer primer ACAATATTAATAGCTTTATGCAA 31238.1     87931259 87931281  
64   PTEN4FdM Forward inner primer TTATAAAGATTCAGGCAA 31238.1     87930950 87930967 58
65   PTEN4RdM Reverse inner primer CTAAAACACAACAGTA 31238.1     87931234 87931249  
66   PTEN5Fd Forward outer primer TAATTAAAAATTCAAGAGTT 31238.1 ex5   87932957 87932976 52
67   PTEN5Rd Reverse outer primer AATAAATTCTCAGATCCAG 31238.1     87933287 87933305  
68   PTEN5FdM Forward inner primer TTTTTTCTTATTCTGAGGTT 31238.1     87932978 87932997 58
69   PTEN5RdM Reverse inner primer CATCAAAAAATAACTTACCTT 31238.1     87933249 87933269  
70   PTEN6Fd Forward outer primer TGTATATATGTTCTTAAATGG 31238.1 ex6   87952007 87952027 52
71   PTEN6Rd Reverse outer primer ATGTGGTAAATTTCTTTCT 31238.1     87952338 87952356  
72   PTEN6FdM Forward inner primer TTACCATAGCAATTTAGTGA 31238.1     87952039 87952058 58
73   PTEN6RdM Reverse inner primer GTAAACTTCTAGATATGGTTA 31238.1     87952307 87952327  
74   PTEN7Fd Forward outer primer ATATTTCGTGTATATTGCTGA 31238.1 ex7   87957747 87957767 56
75   PTEN7Rd Reverse outer primer ATTATAGTTCCTTACATGTCA 31238.1     87958089 87958109  
76   PTEN7FdM Forward inner primer TCGTTTTTGACAGTTTGAC 31238.1     87957783 87957801 58
77   PTEN7RdM Reverse inner primer AATATAGCTTTTAATCTGTCC 31238.1     87958060 87958080  
78   PTEN8Fd Forward outer primer CATTTCATTTCTTTTTCT 31238.1 ex8   87960855 87960872 55
79   PTEN8Rd Reverse outer primer TTCTTCATCAGCTGTACT 31238.1     87961187 87961204  
80   PTEN8FdM Forward inner primer TTTTTTAGGACAAAATGTTTC 31238.1     87960886 87960906 58
81   PTEN8RdM Reverse inner primer TAGAATTAAACACACATCACA 31238.1     87961164 87961184  
82   PTEN9Fd Forward outer primer AATGGAATAAAAAATCTGT 31238.1 ex9   87965194 87965212 52
83   PTEN9Rd Reverse outer primer AAAGGTCCATTTTCAGTTT 31238.1     87965521 87965539  
84   PTEN9FdM Forward inner primer TGAGTCATATTTGTGGGTTT 31238.1     87965243 87965262 58
85   PTEN9RdM Reverse inner primer CATTTTCAGTTTATTCAAGT 31238.1     87965513 87965532  
86                    
87 KRAS KRAS3F Forward outer primer AGGTGCACTGTAATAATCCA 8702.1 ex2 12p12.1 25227454 25227435 60
88   KRAS3R Reverse outer primer ATGGCATTAGCAAAGACTC 8702.1     25227173 25227155  
89   KRAS3FN Forward inner primer TGCACTGTAATAATCCAGA 8702.1     25227451 25227433 60
90   KRAS3RN Reverse inner primer ATTATATTCAATTTAAACCCAC 8702.1     25227233 25227212  
91                    
92 IDH1 IDH1pF Forward primer TCACCAAATGGCACCATACGA 2381.1 ex2 2q34 208248483 208248503 60
93   IDH1pR Reverse primer AATAGGCGTCCATCTCAAC 2381.1     208248156 208248174  
94